0005907: CC results different from GUI results

0005907

MEGA

Alignment Explorer

public

2023-09-15 19:48

Reporter

guest

Assigned To

Priority

normal

Severity

minor

Reproducibility

have not tried

Status

new

Resolution

open

Platform

Mac

OS

OS X

OS Version

other

Product Version

MEGA-CC 11 (command line version)

First Name

Ana

Last Name

Stanescu

Email

astanesc@westga.edu

Confirm Email

astanesc@westga.edu

Summary

0005907: CC results different from GUI results

Description

GUI alignment produces different results than CC alignment using the same data and .mao options. Steps below include:
1. data
2. mao file of the alignment I want to perform
3. mega-CC (command line) results using the .mao from 2
4. mega-GUI results using the same configuration from 2
5. summary of CC results

Other details:
- non-coding DNA
- ClustaW with default parameters.

Steps To Reproduce

1. DATA =============================================
>seq1
acgatcgatcgatcgatcgatgcatcgatcgatcg
agctacgatcgatcgatcgatcgatcgatgcatgg
>seq2
tacattactacatcatgactatcgacgactagcat
ctccatcagcgatcgatcgatcgacatccggcgat
>seq3
atcgactatctatttcgagctacacgacgagagag
ctctcatctatctacactatcgactagcgccgcga
>seq4
atatactatcatcatctactactatcatcggtgac
atacgatcagctacacgagcatcgacgatcagcga
2. MAO =============================================
; Please do not edit this file! If this file is modified, results are unpredictable.
; Instead of modifying this file, simply create a new MEGA Analysis Options file by using MEGA.
[ MEGAinfo ]
ver = 11220621-x86_64 macOS
[ DataSettings ]
datatype = snNucleotide
containsCodingNuc = False
missingBaseSymbol = ?
identicalBaseSymbol = .
gapSymbol = -
[ ProcessTypes ]
ppAlign = true
ppClustalW = true
[ AnalysisSettings ]
Pairwise Alignment = ====================
DNAPWGapOpeningPenalty = 15.00
DNAPWGapExtensionPenalty = 6.66
Multiple Alignment = ====================
DNAMAGapOpeningPenalty = 15.00
DNAMAGapExtensionPenalty = 6.66
Global Options = ====================
DNA Weight Matrix = IUB
TransitionWeightNEdit = 0.50
UseNegativeMatrix = ON
DelayDivergentCutoff = 30
KeepPredefinedGaps = True
3. CC results =========================================
#mega
!Title ;
!Format DataType=DNA indel=-;

#seq1
ACGATCGATCGA--TCGATCGATGC-ATCGATCGATCGAGCTACGATCGATCGAT-CGAT
CGATCGATGCATGG----

#seq2
----TACATTAC--TACATCATGACTATCGACGACTAGCATCTCCATCAG-CGAT-CGAT
CGATCGACATCCGGCGAT

#seq3
---ATCGACTAT--CTATTTCGAGCTACACGACGAGAGAGCTCTCATCTATCTACACTAT
CGACTAGCGCCGCGA---

#seq4
---ATATACTATCATCATCTACTACTATC-ATCGGTGACA-TACGATCAG-CTACACGAG
C-ATCGACGATCAGCGA-

4. GUI results =========================================
#mega
!Title ;
!Format DataType=DNA indel=-;

#seq1
ACGATCGATCGATCGATCGATGC-ATCGATCGATCGAGCTACGATCGATCGAT-CGATCG
ATCGATGCATGG----

#seq2
----TACATTACTACATCATGACTATCGACGACTAGCATCTCCATCAG-CGAT-CGATCG
ATCGACATCCGGCGAT

#seq3
---ATCGACTATCTATTTCGAGCTACACGACGAGAGAGCTCTCATCTATCTACACTATCG
ACTAGCGCCGCGA---

#seq4
---ATATACTATCATCATCTACTACTATCATCGGTGACATACGATCAG-CTACACGAGC-
ATCGACGATCAGCGA-

5. CC summary =======================================
; MEGA-CC (Molecular Evolutionary Genetics Analysis Compute Core)
;
; Suggested Citation for MEGA-CC 11:
;
; Tamura K, Stecher G, and Kumar S.
; MEGA11: Molecular Evolutionary Genetics Analysis version 11.
; Molecular Biology and Evolution (2021) 38:3022-3027
;
; Kumar S, Stecher G, Peterson D, and Tamura K
; MEGA-CC: Computing Core of Molecular Evolutionary Genetics Analysis Program for Automated and Iterative Data Analysis
; Bioinformatics (2012) 28:2685-2686 (Epub 2012 Aug 24)

[Application Info]

    Version = 11.0.13
    Build = 11220620-x86_64
    User Interface = CommandLine
    Operating System = mac

[General Info]

    Data Type = nucleotide (non-coding)
    No. of Taxa = 4
    Data File = 'toy.fasta'
    Settings File = './clustal_align_nucleotide.mao'
    Command Line = megacc -a clustal_align_nucleotide.mao -d toy.fasta -o toy_cc

[Analysis Settings]

    DNAPWGapOpenPenalty = 15.00
    DNAPWGapExtendPenalty = 6.66
    DNAGapOpenPenalty = 15.00
    DNAGapExtendPenalty = 6.66
    DNAMatrix =
    TransitionWeight = 0.50
    UseNegativeMatrix = True
    DivergentCutoff = 30
    ResetGaps = False

[Analysis Statistics]

    Start Time = 15-9-23 22:33:45
    End Time = 15-9-23 22:33:46
    Execution Time = 0.125 (seconds)
    Max Heap Memory Used = 7.539 (MB)

Additional Information

FOR THE SAME fasta file (see step1) I am running default-parameters clustalW alignment:

A. I am running the GUI on a MAC Ventura 13.5.2. The same results are produced on a Windows machine. So GUI is consistent across Mac and Windows.

B. I am running mega-CC on MAC Ventura 13.5.2. and Ubuntu 22.04. The results are consistent across Mac and Ubuntu.

The problem is that GUI vs CC are different!

Is this supposed to happen? If so, then why? And how do I ensure reproducibility of experiments?

MantisBT - MEGA
View Issue Details

ID	Project	Category	View Status	Date Submitted	Last Update
0005907	MEGA	Alignment Explorer	public	2023-09-15 19:48	2023-09-15 19:48

Reporter	guest
Assigned To
Priority	normal	Severity	minor	Reproducibility	have not tried
Status	new	Resolution	open
Platform	Mac	OS	OS X	OS Version	other
Product Version	MEGA-CC 11 (command line version)
Target Version		Fixed in Version
First Name	Ana
Last Name	Stanescu
Email	astanesc@westga.edu
Confirm Email	astanesc@westga.edu

Summary	0005907: CC results different from GUI results
Description	GUI alignment produces different results than CC alignment using the same data and .mao options. Steps below include: 1. data 2. mao file of the alignment I want to perform 3. mega-CC (command line) results using the .mao from 2 4. mega-GUI results using the same configuration from 2 5. summary of CC results Other details: - non-coding DNA - ClustaW with default parameters.
Steps To Reproduce	1. DATA ============================================= >seq1 acgatcgatcgatcgatcgatgcatcgatcgatcg agctacgatcgatcgatcgatcgatcgatgcatgg >seq2 tacattactacatcatgactatcgacgactagcat ctccatcagcgatcgatcgatcgacatccggcgat >seq3 atcgactatctatttcgagctacacgacgagagag ctctcatctatctacactatcgactagcgccgcga >seq4 atatactatcatcatctactactatcatcggtgac atacgatcagctacacgagcatcgacgatcagcga 2. MAO ============================================= ; Please do not edit this file! If this file is modified, results are unpredictable. ; Instead of modifying this file, simply create a new MEGA Analysis Options file by using MEGA. [ MEGAinfo ] ver = 11220621-x86_64 macOS [ DataSettings ] datatype = snNucleotide containsCodingNuc = False missingBaseSymbol = ? identicalBaseSymbol = . gapSymbol = - [ ProcessTypes ] ppAlign = true ppClustalW = true [ AnalysisSettings ] Pairwise Alignment = ==================== DNAPWGapOpeningPenalty = 15.00 DNAPWGapExtensionPenalty = 6.66 Multiple Alignment = ==================== DNAMAGapOpeningPenalty = 15.00 DNAMAGapExtensionPenalty = 6.66 Global Options = ==================== DNA Weight Matrix = IUB TransitionWeightNEdit = 0.50 UseNegativeMatrix = ON DelayDivergentCutoff = 30 KeepPredefinedGaps = True 3. CC results ========================================= #mega !Title ; !Format DataType=DNA indel=-; #seq1 ACGATCGATCGA--TCGATCGATGC-ATCGATCGATCGAGCTACGATCGATCGAT-CGAT CGATCGATGCATGG---- #seq2 ----TACATTAC--TACATCATGACTATCGACGACTAGCATCTCCATCAG-CGAT-CGAT CGATCGACATCCGGCGAT #seq3 ---ATCGACTAT--CTATTTCGAGCTACACGACGAGAGAGCTCTCATCTATCTACACTAT CGACTAGCGCCGCGA--- #seq4 ---ATATACTATCATCATCTACTACTATC-ATCGGTGACA-TACGATCAG-CTACACGAG C-ATCGACGATCAGCGA- 4. GUI results ========================================= #mega !Title ; !Format DataType=DNA indel=-; #seq1 ACGATCGATCGATCGATCGATGC-ATCGATCGATCGAGCTACGATCGATCGAT-CGATCG ATCGATGCATGG---- #seq2 ----TACATTACTACATCATGACTATCGACGACTAGCATCTCCATCAG-CGAT-CGATCG ATCGACATCCGGCGAT #seq3 ---ATCGACTATCTATTTCGAGCTACACGACGAGAGAGCTCTCATCTATCTACACTATCG ACTAGCGCCGCGA--- #seq4 ---ATATACTATCATCATCTACTACTATCATCGGTGACATACGATCAG-CTACACGAGC- ATCGACGATCAGCGA- 5. CC summary ======================================= ; MEGA-CC (Molecular Evolutionary Genetics Analysis Compute Core) ; ; Suggested Citation for MEGA-CC 11: ; ; Tamura K, Stecher G, and Kumar S. ; MEGA11: Molecular Evolutionary Genetics Analysis version 11. ; Molecular Biology and Evolution (2021) 38:3022-3027 ; ; Kumar S, Stecher G, Peterson D, and Tamura K ; MEGA-CC: Computing Core of Molecular Evolutionary Genetics Analysis Program for Automated and Iterative Data Analysis ; Bioinformatics (2012) 28:2685-2686 (Epub 2012 Aug 24) [Application Info] Version = 11.0.13 Build = 11220620-x86_64 User Interface = CommandLine Operating System = mac [General Info] Data Type = nucleotide (non-coding) No. of Taxa = 4 Data File = 'toy.fasta' Settings File = './clustal_align_nucleotide.mao' Command Line = megacc -a clustal_align_nucleotide.mao -d toy.fasta -o toy_cc [Analysis Settings] DNAPWGapOpenPenalty = 15.00 DNAPWGapExtendPenalty = 6.66 DNAGapOpenPenalty = 15.00 DNAGapExtendPenalty = 6.66 DNAMatrix = TransitionWeight = 0.50 UseNegativeMatrix = True DivergentCutoff = 30 ResetGaps = False [Analysis Statistics] Start Time = 15-9-23 22:33:45 End Time = 15-9-23 22:33:46 Execution Time = 0.125 (seconds) Max Heap Memory Used = 7.539 (MB)
Additional Information	FOR THE SAME fasta file (see step1) I am running default-parameters clustalW alignment: A. I am running the GUI on a MAC Ventura 13.5.2. The same results are produced on a Windows machine. So GUI is consistent across Mac and Windows. B. I am running mega-CC on MAC Ventura 13.5.2. and Ubuntu 22.04. The results are consistent across Mac and Ubuntu. The problem is that GUI vs CC are different! Is this supposed to happen? If so, then why? And how do I ensure reproducibility of experiments?
Tags	No tags attached.
Relationships
Attached Files

Issue History
Date Modified	Username	Field	Change
2023-09-15 19:48	guest	New Issue