MantisBT - MEGA
View Issue Details
IDProjectCategoryView StatusDate SubmittedLast Update
0000669MEGA[All Projects] Feedbackpublic2018-02-27 04:052018-02-27 09:58
Reporterguest 
Assigned Togstecher 
PrioritynormalSeverityminorReproducibilityhave not tried
StatusresolvedResolutionno change required 
PlatformOSOS Version
Product Version 
Target VersionFixed in Version 
First NameKlaus
Last NameKoepfli
Emailklauspeter.koepfli527@gmail.com
Confirm Emailklauspeter.koepfli527@gmail.com
Summary0000669: Estimating timetree using RelTime with Mb-long alignment
DescriptionHello,

I'm currently working with a group of researchers analyzing a phylogenomic data set (0000048:0000003.2 Mb of SNPs) from 11 species of canids. Besides MCMCTree, I'm interested in using RelTime is estimate a timetree from these data. I was wondering if MEGA7 could be used for analyses of data matrices containing millions of sites? When I try to load the alignment into MEGA7, I get an error message, "Line too long." Is it possible to resolve this issue? Thank you.
Steps To Reproduce
Additional Information
TagsNo tags attached.
Relationships
Attached Files
Issue History
Date ModifiedUsernameFieldChange
2018-02-27 04:05guestNew Issue
2018-02-27 09:49gstecherFile Deleted: prueba1.meg
2018-02-27 09:58gstecherNote Added: 0003915
2018-02-27 09:58gstecherStatusnew => resolved
2018-02-27 09:58gstecherResolutionopen => no change required
2018-02-27 09:58gstecherAssigned To => gstecher

Notes
(0000613)
Nikita Vikhrev   
1969-12-31 17:33   
Joel used to handle file format converter. Should I take over? If so, could you get me information about the file formats? Thanks.
(0000660)
paul   
1969-12-31 17:33   
Send Sudhir\'s answer to user. Not a bug. Close.

\'Dear User:
   You need to convert the format of the data file from MSF to MEGA. This can be done by opening your MSF file (it should have .msf extension) in MEGA text editor and then use the \'Utilities|Convert to MEGA format\' option to convert the file to MEGA format. I tested it and it works. Sudhir\"
(0003915)
gstecher   
2018-02-27 09:58   
Hi Klaus,

I am writing in response to your question regarding the Reltime analysis in the MEGA software. The Reltime analysis will probably NOT work for alignments that have millions of sites as it uses the Maximum Likelihood framework in MEGA which does not scale well for long alignments. You may be able to resolve the 'line too long' error by breaking long lines apart like in the sequence below:

>Artemia_salina
TAATTAAAGGGCCGTGGTATA-CTGACCATGCGAAGGTAGCATAATCATTAGCCTTTTGATTTGAGGCTG
GAATGAATGGTTTGACGAGAGATGGTCTGTCTC--TTCGAT-TAAATTGAAGTTAATCTTTAAGTGAAAA
AGCTTAAATGTACTTGGAGGGCGATAAGACCCTATAGATCTTTACATTTAAT-TCTTTTGTCTTGCGGTA
G-GTAATTAGACAGAGTA---AAACA------ATGTTCGGTTGGGGCGACGGTAAGA--ACAGAATAAAC
-ACTTACAACATAAACACATCAATAAATGACCA-------TTGATCCT-TAGATGAAT--AAAGACCAAG
TTACCTTAGGGATAACAGCGTAATTCTTTTTTGAGAGTTCAAATCGACAAAAGAGTTTGCGAGCCTCGAT

--
Best regards,

Glen Stecher
Institute for Genomics and Evolutionary Medicine
igem.temple.edu