| Anonymous | Login | Signup for a new account | 2024-11-22 09:04 MST |  |
| My View | View Issues | Report Issue | Change Log | Roadmap | My Account |
| View Issue Details [ Jump to Notes ] | [ Issue History ] [ Print ] | ||||||||
| ID | Project | Category | View Status | Date Submitted | Last Update | ||||
| 0000493 | MEGA | [All Projects] Feedback | public | 2017-07-07 08:45 | 2024-03-05 10:28 | ||||
| Reporter | guest | ||||||||
| Assigned To | gstecher | ||||||||
| Priority | normal | Severity | minor | Reproducibility | have not tried | ||||
| Status | resolved | Resolution | won't fix | ||||||
| Platform | OS | ||||||||
| Product Version | MEGA-CC 11 (command line version) | ||||||||
| Target Version | Fixed in Version | ||||||||
| Summary | 0000493: protein align (Some sequences are too divergent to be aligned) | ||||||||
| Description | Hi, I want to align multiple protein sequences with megacc. I runned './megacc -a ~/clustal_align_protein.mao -d ./input.fa -f Fasta -o outfile ', and got an error message 'Error occured curing ClustalW alignment: Some sequences are too divergent to be aligned.'. How can I ignore this error message and get a alignment outfile? In mega-GUI version, there is a dialog box that I can choose "ignore" button. But I don't know how to do with mega-cc. Hope for your reply. Thank you ! | ||||||||
| Tags | No tags attached. | ||||||||
| Attach Tags | (Separate by ",") | ||||||||
| First Name | liwei | ||||||||
| Last Name | Liu | ||||||||
| wanwan1226@qq.com | |||||||||
| Confirm Email | wanwan1226@qq.com | ||||||||
| Attached Files | |||||||||
 Relationships |
|
 Relationships |
|
Notes |
|
|
(0003827) gstecher (administrator) 2017-07-11 09:02 |
Hi Liwei, I am writing in response to your question regarding the MEGA software. In MEGA-CC there is not a way to ignore the error that alignment by ClustalW is showing. This is because MEGA-CC is not an interactive application like MEGA-GUI. -- Best regards, Glen Stecher Institute for Genomics and Evolutionary Medicine igem.temple.edu |
|
Notes |
|
Issue History |
|||
| Date Modified | Username | Field | Change |
| 2017-07-07 08:45 | guest | New Issue | |
| 2017-07-10 12:13 | gstecher | File Deleted: AA Ae data.meg | |
| 2017-07-11 09:02 | gstecher | Note Added: 0003827 | |
| 2017-07-11 09:02 | gstecher | Status | new => resolved |
| 2017-07-11 09:02 | gstecher | Resolution | open => won't fix |
| 2017-07-11 09:02 | gstecher | Assigned To | => gstecher |
| 2024-02-16 00:59 | guest | Tag Attached: >TP6 ATGCGGTGGAAAACTTCCTCCAACCACACCCAAACCCTCGCTGCTCACTGTCTCTCCCGCTTCGAAGAAGCCGTCCCCGTCCTCGAACGCGCCAT | |
| 2024-03-05 10:28 | guest | Tag Detached: >TP6 ATGCGGTGGAAAACTTCCTCCAACCACACCCAAACCCTCGCTGCTCACTGTCTCTCCCGCTTCGAAGAAGCCGTCCCCGTCCTCGAACGCGCCAT | |
|
Issue History |
| Copyright © 2000 - 2024 MantisBT Team |
|