Anonymous | Login | Signup for a new account | 2024-11-22 08:46 MST |
My View | View Issues | Report Issue | Change Log | Roadmap | My Account |
View Issue Details [ Jump to Notes ] | [ Issue History ] [ Print ] | ||||||||
ID | Project | Category | View Status | Date Submitted | Last Update | ||||
0000493 | MEGA | [All Projects] Feedback | public | 2017-07-07 08:45 | 2024-03-05 10:28 | ||||
Reporter | guest | ||||||||
Assigned To | gstecher | ||||||||
Priority | normal | Severity | minor | Reproducibility | have not tried | ||||
Status | resolved | Resolution | won't fix | ||||||
Platform | OS | ||||||||
Product Version | MEGA-CC 11 (command line version) | ||||||||
Target Version | Fixed in Version | ||||||||
Summary | 0000493: protein align (Some sequences are too divergent to be aligned) | ||||||||
Description | Hi, I want to align multiple protein sequences with megacc. I runned './megacc -a ~/clustal_align_protein.mao -d ./input.fa -f Fasta -o outfile ', and got an error message 'Error occured curing ClustalW alignment: Some sequences are too divergent to be aligned.'. How can I ignore this error message and get a alignment outfile? In mega-GUI version, there is a dialog box that I can choose "ignore" button. But I don't know how to do with mega-cc. Hope for your reply. Thank you ! | ||||||||
Tags | No tags attached. | ||||||||
Attach Tags | (Separate by ",") | ||||||||
First Name | liwei | ||||||||
Last Name | Liu | ||||||||
wanwan1226@qq.com | |||||||||
Confirm Email | wanwan1226@qq.com | ||||||||
Attached Files | |||||||||
Notes | |
(0003827) gstecher (administrator) 2017-07-11 09:02 |
Hi Liwei, I am writing in response to your question regarding the MEGA software. In MEGA-CC there is not a way to ignore the error that alignment by ClustalW is showing. This is because MEGA-CC is not an interactive application like MEGA-GUI. -- Best regards, Glen Stecher Institute for Genomics and Evolutionary Medicine igem.temple.edu |
Issue History | |||
Date Modified | Username | Field | Change |
2017-07-07 08:45 | guest | New Issue | |
2017-07-10 12:13 | gstecher | File Deleted: AA Ae data.meg | |
2017-07-11 09:02 | gstecher | Note Added: 0003827 | |
2017-07-11 09:02 | gstecher | Status | new => resolved |
2017-07-11 09:02 | gstecher | Resolution | open => won't fix |
2017-07-11 09:02 | gstecher | Assigned To | => gstecher |
2024-02-16 00:59 | guest | Tag Attached: >TP6 ATGCGGTGGAAAACTTCCTCCAACCACACCCAAACCCTCGCTGCTCACTGTCTCTCCCGCTTCGAAGAAGCCGTCCCCGTCCTCGAACGCGCCAT | |
2024-03-05 10:28 | guest | Tag Detached: >TP6 ATGCGGTGGAAAACTTCCTCCAACCACACCCAAACCCTCGCTGCTCACTGTCTCTCCCGCTTCGAAGAAGCCGTCCCCGTCCTCGAACGCGCCAT |
Copyright © 2000 - 2024 MantisBT Team |