| Anonymous | Login | Signup for a new account | 2024-11-22 13:45 MST |  |
| My View | View Issues | Report Issue | Change Log | Roadmap | My Account |
| View Issue Details [ Jump to Notes ] | [ Issue History ] [ Print ] | ||||||||
| ID | Project | Category | View Status | Date Submitted | Last Update | ||||
| 0000669 | MEGA | [All Projects] Feedback | public | 2018-02-27 04:05 | 2018-02-27 09:58 | ||||
| Reporter | guest | ||||||||
| Assigned To | gstecher | ||||||||
| Priority | normal | Severity | minor | Reproducibility | have not tried | ||||
| Status | resolved | Resolution | no change required | ||||||
| Platform | OS | ||||||||
| Product Version | MEGA 11 (Graphical Interface version) | ||||||||
| Target Version | Fixed in Version | ||||||||
| Summary | 0000669: Estimating timetree using RelTime with Mb-long alignment | ||||||||
| Description | Hello, I'm currently working with a group of researchers analyzing a phylogenomic data set (0000048:0000003.2 Mb of SNPs) from 11 species of canids. Besides MCMCTree, I'm interested in using RelTime is estimate a timetree from these data. I was wondering if MEGA7 could be used for analyses of data matrices containing millions of sites? When I try to load the alignment into MEGA7, I get an error message, "Line too long." Is it possible to resolve this issue? Thank you. | ||||||||
| Tags | No tags attached. | ||||||||
| Attach Tags | (Separate by ",") | ||||||||
| First Name | Klaus | ||||||||
| Last Name | Koepfli | ||||||||
| klauspeter.koepfli527@gmail.com | |||||||||
| Confirm Email | klauspeter.koepfli527@gmail.com | ||||||||
| Attached Files | |||||||||
 Relationships |
|
 Relationships |
|
Notes |
|
|
(0000613) Nikita Vikhrev (reporter) 1969-12-31 17:33 |
Joel used to handle file format converter. Should I take over? If so, could you get me information about the file formats? Thanks. |
|
(0000660) paul (reporter) 1969-12-31 17:33 |
Send Sudhir\'s answer to user. Not a bug. Close. \'Dear User: You need to convert the format of the data file from MSF to MEGA. This can be done by opening your MSF file (it should have .msf extension) in MEGA text editor and then use the \'Utilities|Convert to MEGA format\' option to convert the file to MEGA format. I tested it and it works. Sudhir\" |
|
(0003915) gstecher (administrator) 2018-02-27 09:58 |
Hi Klaus, I am writing in response to your question regarding the Reltime analysis in the MEGA software. The Reltime analysis will probably NOT work for alignments that have millions of sites as it uses the Maximum Likelihood framework in MEGA which does not scale well for long alignments. You may be able to resolve the 'line too long' error by breaking long lines apart like in the sequence below: >Artemia_salina TAATTAAAGGGCCGTGGTATA-CTGACCATGCGAAGGTAGCATAATCATTAGCCTTTTGATTTGAGGCTG GAATGAATGGTTTGACGAGAGATGGTCTGTCTC--TTCGAT-TAAATTGAAGTTAATCTTTAAGTGAAAA AGCTTAAATGTACTTGGAGGGCGATAAGACCCTATAGATCTTTACATTTAAT-TCTTTTGTCTTGCGGTA G-GTAATTAGACAGAGTA---AAACA------ATGTTCGGTTGGGGCGACGGTAAGA--ACAGAATAAAC -ACTTACAACATAAACACATCAATAAATGACCA-------TTGATCCT-TAGATGAAT--AAAGACCAAG TTACCTTAGGGATAACAGCGTAATTCTTTTTTGAGAGTTCAAATCGACAAAAGAGTTTGCGAGCCTCGAT -- Best regards, Glen Stecher Institute for Genomics and Evolutionary Medicine igem.temple.edu |
|
Notes |
|
Issue History |
|||
| Date Modified | Username | Field | Change |
| 2018-02-27 04:05 | guest | New Issue | |
| 2018-02-27 09:49 | gstecher | File Deleted: prueba1.meg | |
| 2018-02-27 09:58 | gstecher | Note Added: 0003915 | |
| 2018-02-27 09:58 | gstecher | Status | new => resolved |
| 2018-02-27 09:58 | gstecher | Resolution | open => no change required |
| 2018-02-27 09:58 | gstecher | Assigned To | => gstecher |
|
Issue History |
| Copyright © 2000 - 2024 MantisBT Team |
|